Virus:Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PCM1 Polyclonal antibody Proteintech Cat# 19856-1-AP; RRID: AB_2878616 ARL13B Polyclonal antibody Proteintech Cat# 17711-1-AP; RRID: AB_2060867 Alpha Tubulin Polyclonal antibody Proteintech Cat # 11224-1-AP; RRID: AB_2210206 AZI1 Polyclonal antibody Proteintech Cat# 25735-1-AP; RRID: AB_2880216 Ubiquitin (P4D1) Mouse mAb CST Cat# 3936; RRID: AB_331292 PCM1 Antibody (G-6) Santa Cruz Biotechnology Cat# sc-398365; RRID: AB_2827155 PML Antibody (PG-M3) Santa Cruz Biotechnology Cat# sc-966; RRID: AB_628162 SP100 antibody GeneTex Cat# GTX131569; RRID: AB_2886502 Coilin Polyclonal antibody Proteintech Cat# 10967-1-AP; RRID: AB_2276345 Anti-Cleaved-SUMO-2/3 (G93) Rabbit Polyclonal Antibody HUABIO Cat# ER60035 Anti-Pericentrin antibody Abcam Cat# ab4448; RRID: AB_304461 Mouse Anti-Ubiquitinylated proteins Monoclonal antibody, Unconjugated, Clone fk2 Millipore Cat# 04–263; RRID: AB_612093 Mouse monoclonal HA-tag antibody (F-7) Santa Cruz Biotechnology Cat# sc-7392; RRID: AB_627809 Mouse monoclonal anti-GFP antibody (B-2) Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Rabbit polyclonal anti-mCherry antibody Proteintech Cat# 26765-1-AP; RRID: AB_2876881 Mouse monoclonal anti-Flag antibody Sigma-Aldrich Cat# F1804; RRID: AB_262044 Mouse monoclonal anti-GAPDH antibody Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, A lexa FluorTM 488 Thermo Fisher Cat# A-11029; RRID: AB_2534088 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21422; RRID: AB_2535844 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21235; RRID: AB_2535804 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Cat# A-11008; RRID: AB_143165 (Continued on next page) 18 Cell Reports 44, 115766, June 24, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025
Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Recombinant:Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PCM1 Polyclonal antibody Proteintech Cat# 19856-1-AP; RRID: AB_2878616 ARL13B Polyclonal antibody Proteintech Cat# 17711-1-AP; RRID: AB_2060867 Alpha Tubulin Polyclonal antibody Proteintech Cat # 11224-1-AP; RRID: AB_2210206 AZI1 Polyclonal antibody Proteintech Cat# 25735-1-AP; RRID: AB_2880216 Ubiquitin (P4D1) Mouse mAb CST Cat# 3936; RRID: AB_331292 PCM1 Antibody (G-6) Santa Cruz Biotechnology Cat# sc-398365; RRID: AB_2827155 PML Antibody (PG-M3) Santa Cruz Biotechnology Cat# sc-966; RRID: AB_628162 SP100 antibody GeneTex Cat# GTX131569; RRID: AB_2886502 Coilin Polyclonal antibody Proteintech Cat# 10967-1-AP; RRID: AB_2276345 Anti-Cleaved-SUMO-2/3 (G93) Rabbit Polyclonal Antibody HUABIO Cat# ER60035 Anti-Pericentrin antibody Abcam Cat# ab4448; RRID: AB_304461 Mouse Anti-Ubiquitinylated proteins Monoclonal antibody, Unconjugated, Clone fk2 Millipore Cat# 04–263; RRID: AB_612093 Mouse monoclonal HA-tag antibody (F-7) Santa Cruz Biotechnology Cat# sc-7392; RRID: AB_627809 Mouse monoclonal anti-GFP antibody (B-2) Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Rabbit polyclonal anti-mCherry antibody Proteintech Cat# 26765-1-AP; RRID: AB_2876881 Mouse monoclonal anti-Flag antibody Sigma-Aldrich Cat# F1804; RRID: AB_262044 Mouse monoclonal anti-GAPDH antibody Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, A lexa FluorTM 488 Thermo Fisher Cat# A-11029; RRID: AB_2534088 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21422; RRID: AB_2535844 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21235; RRID: AB_2535804 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Cat# A-11008; RRID: AB_143165 (Continued on next page) 18 Cell Reports 44, 115766, June 24, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025
Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Protease Inhibitor:Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PCM1 Polyclonal antibody Proteintech Cat# 19856-1-AP; RRID: AB_2878616 ARL13B Polyclonal antibody Proteintech Cat# 17711-1-AP; RRID: AB_2060867 Alpha Tubulin Polyclonal antibody Proteintech Cat # 11224-1-AP; RRID: AB_2210206 AZI1 Polyclonal antibody Proteintech Cat# 25735-1-AP; RRID: AB_2880216 Ubiquitin (P4D1) Mouse mAb CST Cat# 3936; RRID: AB_331292 PCM1 Antibody (G-6) Santa Cruz Biotechnology Cat# sc-398365; RRID: AB_2827155 PML Antibody (PG-M3) Santa Cruz Biotechnology Cat# sc-966; RRID: AB_628162 SP100 antibody GeneTex Cat# GTX131569; RRID: AB_2886502 Coilin Polyclonal antibody Proteintech Cat# 10967-1-AP; RRID: AB_2276345 Anti-Cleaved-SUMO-2/3 (G93) Rabbit Polyclonal Antibody HUABIO Cat# ER60035 Anti-Pericentrin antibody Abcam Cat# ab4448; RRID: AB_304461 Mouse Anti-Ubiquitinylated proteins Monoclonal antibody, Unconjugated, Clone fk2 Millipore Cat# 04–263; RRID: AB_612093 Mouse monoclonal HA-tag antibody (F-7) Santa Cruz Biotechnology Cat# sc-7392; RRID: AB_627809 Mouse monoclonal anti-GFP antibody (B-2) Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Rabbit polyclonal anti-mCherry antibody Proteintech Cat# 26765-1-AP; RRID: AB_2876881 Mouse monoclonal anti-Flag antibody Sigma-Aldrich Cat# F1804; RRID: AB_262044 Mouse monoclonal anti-GAPDH antibody Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, A lexa FluorTM 488 Thermo Fisher Cat# A-11029; RRID: AB_2534088 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21422; RRID: AB_2535844 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21235; RRID: AB_2535804 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Cat# A-11008; RRID: AB_143165 (Continued on next page) 18 Cell Reports 44, 115766, June 24, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025
Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Transfection:Article Title: Coiled-coil-domain-mediated TRIM E3 protein condensation modulates enzymatic activity and functional specificity.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PCM1 Polyclonal antibody Proteintech Cat# 19856-1-AP; RRID: AB_2878616 ARL13B Polyclonal antibody Proteintech Cat# 17711-1-AP; RRID: AB_2060867 Alpha Tubulin Polyclonal antibody Proteintech Cat # 11224-1-AP; RRID: AB_2210206 AZI1 Polyclonal antibody Proteintech Cat# 25735-1-AP; RRID: AB_2880216 Ubiquitin (P4D1) Mouse mAb CST Cat# 3936; RRID: AB_331292 PCM1 Antibody (G-6) Santa Cruz Biotechnology Cat# sc-398365; RRID: AB_2827155 PML Antibody (PG-M3) Santa Cruz Biotechnology Cat# sc-966; RRID: AB_628162 SP100 antibody GeneTex Cat# GTX131569; RRID: AB_2886502 Coilin Polyclonal antibody Proteintech Cat# 10967-1-AP; RRID: AB_2276345 Anti-Cleaved-SUMO-2/3 (G93) Rabbit Polyclonal Antibody HUABIO Cat# ER60035 Anti-Pericentrin antibody Abcam Cat# ab4448; RRID: AB_304461 Mouse Anti-Ubiquitinylated proteins Monoclonal antibody, Unconjugated, Clone fk2 Millipore Cat# 04–263; RRID: AB_612093 Mouse monoclonal HA-tag antibody (F-7) Santa Cruz Biotechnology Cat# sc-7392; RRID: AB_627809 Mouse monoclonal anti-GFP antibody (B-2) Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Rabbit polyclonal anti-mCherry antibody Proteintech Cat# 26765-1-AP; RRID: AB_2876881 Mouse monoclonal anti-Flag antibody Sigma-Aldrich Cat# F1804; RRID: AB_262044 Mouse monoclonal anti-GAPDH antibody Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, A lexa FluorTM 488 Thermo Fisher Cat# A-11029; RRID: AB_2534088 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21422; RRID: AB_2535844 Goat anti-Mouse IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21235; RRID: AB_2535804 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Cat# A-11008; RRID: AB_143165 (Continued on next page) 18 Cell Reports 44, 115766, June 24, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 555 Thermo Fisher Cat# A-21428; RRID: AB_2535849 Goat anti-Rabbit IgG (H + L) CrossAdsorbed Secondary Antibody, Alexa FluorTM 647 Thermo Fisher Cat# A-21245; RRID: AB_2535813 Goat anti-Mouse IgG H&L (IRDye® 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 Streptavidin, Alexa FluorTM 555 conjugate Thermo Fisher Cat# S21381; RRID: AB_2307336 Streptavidin Protein, DyLightTM 680 Thermo Fisher Cat# 21848 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell TIANGEN Cat# CB108-02 DH5α Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins ATP Sigma-Aldrich Cat# A26209-50G Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma-Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Protease Inhibitor Cocktail (EDTA-Free,100× in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S MG-132 MCE Cat# HY-13259 TAK243 TargetMol Cat# T16974 Rapamycin MCE Cat# HY-10219 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154-100G Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Sodium deoxycholate Beyotime Cat# ST2049-100g PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 Nocodazole MCE Cat# HY-13520-10 mg Biotin Sigma-Aldrich Cat# B4501-1G Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# 11995500CP Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 DMEM/F-12 Thermo Fisher Cat# 11320033 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 mTeSRTM1 stem cell Cat# 85850 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 (Continued on next page) Cell Reports 44, 115766, June 24, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G Poly(I:C) LMW invivogen Cat# tlrl-picw Ficoll400 Sigma-Aldrich Cat# F2637 D-Sorbitol Sigma-Aldrich Cat# S1876 GFP-Trap® Magnetic Agarose Chromotek Cat# gtma-20 DynabeadsTM MyOneTM Streptavidin C1 Thermo Fisher Cat# 65002 Polybrene Solarbio Cat# H8761 ChamQ Universal SYBR qPCR Master Mix Vazyme Cat# Q711-02 LysoTracker® Deep Red Thermo Fisher Cat# L12492 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312-01 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505-d2 PrimeSTAR® Max DNA Polymerase Takara Cat# R045A 2×Specific Taq Master Mix (Quick Load) Novoprotein Cat# E010-02A ClonExpress II One-Step Cloning Kit Vazyme Cat# C112-02 NovoRec® plus One step PCR Cloning Kit Novoprotein Cat# NR005-01B FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301-01 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 Nitrocellulose membrane Pall Cat# 66485 Glutathione Resin Genscript Cat# L00206 High-Affinity Ni-Charged Resin FF Genscript Cat# L00666 Deposited data 21 TRIM proteins MS data via TurboIDmediated proximity labeling in U2OS cells This paper PXD063270 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-5030 Human: HEK293T WT Cell Bank, Chinese Academy of Sciences Cat# SCSP-502 Human: RPE-1 cells ATCC Cat# CRL-4000 Human: ESCs WiCell WA09(H9) Human: U2OS TRIM47-mNeonGreen KI This paper N/A Human: U2OS TRIM38-tdTomato KI This paper N/A Human: ESC TRIM27-mNeonGreen KI This paper N/A Human: U2OS tdTomato-PML KI This paper N/A Oligonucleotides TRIM47 KI gRNA targeting sequence: GCTGAAGAGGAGGTGATGCC This paper N/A TRIM38 KI gRNA targeting sequence: TGGTTTAACCAGCACAGAGA This paper N/A TRIM27 KI gRNA targeting sequence: ATGGAGACCTCCCCTTGAGG This paper N/A TRIM19 KI gRNA targeting sequence: TCGGGCGGGTGCAGGCTCCA This paper N/A Recombinant DNA PCDH-CMV-mCherry This paper N/A PCDH-CMV-mCherry-TRIM1 This paper N/A PCDH-CMV-mCherry-TRIM2 This paper N/A (Continued on next page) 20 Cell Reports 44, 115766, June 24, 2025
Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Electron Microscopy:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Reverse Transcription:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Binding Assay:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
SYBR Green Assay:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Mutagenesis:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Polymerase Chain Reaction:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Mass Spectrometry:Article Title: A disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ph antibody (rabbit) Francis lab 66 N/A Psc antibody (mouse) DSHB Cat# 6E8; RRID: AB_528437 GFP antibody (mouse) DSHB Cat# DSHB-GFP-4C9; RRID: AB_2617422 GFP antibody (mouse) DSHB Cat# DSHB-GFP-12E6; RRID: AB_2617418 GFP antibody (rabbit) Proteintech Cat# 50430-2-AP; RRID: AB_11042881 anti-mouse IgG (rabbit) Abcam Cat# ab171870 Pc antibody (rabbit) Kind gift of J. Mü ller 85 N/A α-Tubulin antibody (mouse) Sigma Aldrich Cat# T5168; RRID: AB_477579 anti-mouse IgG Alexa Fluor 680 conjugated (goat) Thermo Fisher Scientific Cat# A-21057; RRID: AB_141436 anti-rabbit IgG IRDye 800 CW conjugated (goat) LICOR Cat# 925-32211; RRID: AB_2651127 Bacterial and virus strains NEB 5-alpha E. coli NEB Cat# C2987H NEB Turbo E. coli NEB Cat# C2984H DH10Bac E. coli Thermo Fisher Scientific Cat# 10361012 BL21 (DE3) Rosetta pLysS E. coli Sigma Aldrich Cat# 70956-M BL21(DE3) LOBSTR-RIL E. coli Gift from Franç ois Robert lab N/A BL21 Gold (DE3) pLysS E. coli Agilent Cat# 230134 Chemicals, peptides, and recombinant proteins Zeba Spin Desalting Column Thermo Fisher Scientific Cat# 89882 M3 media US Biological Cat# S1013 FBS (for insect cell media) Wisent Cat# 920-045 FBS (for mammalian cell media) Wisent Cat# 080-150 Zeocin Thermo Fisher Scientific Cat# J67140 Blasticidin Wisent Cat# 450-190 Hygromycin Wisent Cat# 400-141 LR Clonase II Thermo Fisher Scientific Cat# 11791020 NEBuilder HiFi DNA Assembly Master Mix NEB Cat# E2621 anti-FLAG M2 Affinity Gel Sigma-Aldrich Cat# A2220 ATP (lithium salt) Roche Cat# 11140965001 Benzonase Sigma-Aldrich Cat# E1014 Proteinase K BioBasic Cat# PB0451 SYBR Gold Thermo Fisher Scientific Cat# S11494 Cy3 NHS ester Cytiva Cat# 25-9004 Hellmanex III Sigma-Aldrich Cat# Z805939 Sigmacote Sigma-Aldrich Cat# SL2 Pluronic F-127 Sigma-Aldrich Cat# P2443 Glucose Oxidase Sigma-Aldrich Cat# G0543 Catalase Sigma-Aldrich Cat# C3155 TransIT-Insect Transfection Reagent Mirus Cat# 6105 Concanavalin A Medicago Cat# 05-0106 Puromycin Wisent Cat# 400-160 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e15, June 5, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD Polymerase Millipore Sigma Cat# 71086 TransIT-293 Transfection Reagent Mirus Cat# 2704 Poly-L-Lysine Electron Microscopy Sciences Cat# 19320-A DRAQ5 Thermo Fisher Scientific Cat# 62251 DAPI Sigma Aldrich Cat# D9542 N-propyl gallate Fluka Cat# 02370 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 RNAse-free water Wisent Cat# 809-115 DNAse I NEB Cat# M0303L Superscript IV Reverse Transcriptase Thermo Fisher Scientific Cat# 18090050 Deoxynucleotide (dNTP) Mix NEB Cat# N0447 RNAse Inhibitor, Murine NEB Cat# M0314 RNAse A BioShop Cat# RNA675 NTB Binding buffer Macherey-Nagel Cat# 740595 Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D Bovine Serum Albumine (BSA) BioShop Cat# ALB001 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 MS-grade water Thermo Fisher Scientific Cat# W6-4 Critical commercial assays QuickChange Lightning Site-Directed Mutagenesis Kit Agilent Cat# 210518 RNA Clean & Concentrator-5 Kit Zymo Research Cat# R1013 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat# 740609 Deposited data Mass spectrometry data This study PRIDE: PXD060324 Experimental models: Cell lines Sf9 cells Expression Systems Cat# 94-001F Kc167 cells Gift from François Robert lab N/A Flp-IN T-REx 293 cells Gift from Jean-Franç ois Cô té lab N/A Experimental models: Organisms/strains D. melanogaster: hh-Gal4/tub-Gal80ts: y[1],w[*]; P{w[+mC], hh-Gal4}, P{w[+mC]=tubP-GAL80ts}2/TM6B,Tb[1] Gift from David Hipfner lab N/A D. melanogaster: H2Av-RFP: w[*]; P{w[+mC]=His2Av-mRFP1}II.2 Gift from David Hipfner lab Stock# 23651; RRID: BDSC_23651 D. melanogaster: UAS-GFP-nls: w[1118]; P{w[+mC]=UAS-GFP.nls}8 Gift from David Hipfner lab Stock# 4776; RRID: BDSC_4776 D. melanogaster: UAS-Venus-Ph WT : w[1118];y[+],{w[+mC]UASVenus-Ph WT }attP2/TM3, Sb1, e 1 This study N/A D. melanogaster: UAS-Venus-Ph PHC3L : w[1118];y[+],{w[+mC], UAS-Venus-Ph PHC3L }attP2/TM3, Sb 1 , e 1 This study N/A D. melanogaster: UAS-Venus-Ph SAMsurf : w[1118];y[+],{w[+mC], UAS-Venus-Ph SAMsurf }attP2/TM3, Sb 1 , e 1 This study N/A Oligonucleotides Random hexamers IDT Cat# 51-01-18-26 Primer and DNA sequences are listed in Table S6 This study N/A Recombinant DNA Gateway donor Seif et al. 31 N/A pMTVBH This study N/A (Continued on next page) Molecular Cell 85, 1–19.e1–e15, June 5, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST-VF This study N/A pAc5-H2Av-RFP-Blast This study N/A pFBFGv2 mini-Ph variants This study N/A pET-mini-Ph EH Seif et al.31 N/A pET-mini-Ph PHC3L-EH/SAMsurf-EH This study N/A pET-HisSUMO-hGSDMD Kambara et al. 86 Addgene #111559; RRID: Addgene_111559 pET-HisSUMO-Linker-SAM variants This study N/A pET-Linker-SAM variants (for AUC) This study N/A pAc5-sgRNA-Cas9 Bassett et al. 87 Addgene #49330; RRID: Addgene_49330 pCRISPaint-TagRFP-T2A-PuroR Schmid-Burgk et al. 57 Addgene #80971; RRID: Addgene_80971 pCRISPaint Ph iV templates This study N/A pUASt-attB Gift from David Hipfner lab N/A pFGET19-Ulp1 Guerrero et al. 88 Addgene #64697; RRID: Addgene_64697 pCFD3-Frame selector 1 Bosch et al. 58 Addgene #127554; RRID: Addgene_127554 pOG44 Gift from Jean-Franç ois Cô té lab N/A Software and algorithms ASTRA (v6.1.6.5) Wyatt Technology N/A AcquireMP and DiscoverMP Refeyn N/A FlowJo (v10.7.2) BD N/A QuantStudio Design&Analysis (v1.5.3) Thermo Fisher Scientific N/A Zen 2012 Zeiss N/A Fiji (ImageJ v1.54g) Schindelin et al. 89 N/A ImageQuant TL (v8.1.0.0) Cytiva N/A GraphPad Prism 10 (v10.3.0) Dotmatics N/A MaxQuant (v2.4.0.0) Cox and Mann 90 N/A CellProfiler (v4.2.5) Stirling et al. 91 N/A Zen 2 (Blue Edition) Zeiss N/A Illastik (v1.3.3) Berg et al. 92 N/A Adobe Illustrator 2023 (v27.5) Adobe N/A Excel (v2412) Microsoft N/A Adobe InDesign 2025 (v20.0.1) Adobe N/A Other Amicon 10 kDa MWCO Concentrator Millipore Cat# UFC5010BK HisTrap-HP Column (1 ml) Cytiva Cat# 29051021 HiTrapQ-HP Column (1 ml) Cytiva Cat# 29051325 HisTrap-HP Column (5 ml) Cytiva Cat# 17524801 HiTrapQ-HP Column (5 ml) Cytiva Cat# 17115401 Superdex 200 10/300 GL Cytiva Cat# 28990944 HiTrap SP HP (5 ml) Cytiva Cat# 17115201 Superdex 75 26/600 Cytiva Cat# 28989334 384-well imaging plate (SensoPlate) Greiner Bio-One Cat# 781892 (Continued on next page) e3 Molecular Cell 85, 1–19.e1–e15, June 5, 2025
Generated:Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Real-time Polymerase Chain Reaction:Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Lysis:Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
Magnetic Beads:Article Title: Traffic Jam activates the Flamenco piRNA cluster locus and the Piwi pathway to ensure transposon silencing and Drosophila fertility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TJ (rabbit) This study, Lau lab generated rabbit polycolonal, from Rivera et al. From Rivera et al.46 Anti-TJ (guinea pig) Godt lab generated guinea pig polycolonal from Li et al.25 From Li et al.25 Anti-Piwi Lau lab generated rabbit polycolonal from Sytnikova et al.30 From Sytnikova et al.30 Anti-Armi (2F8A9) National Institute of Genetics of Japan Cat#1011Ab-1 Anti-Yb National Institute of Genetics of Japan Cat#1012Ab-1 Anti-Mael National Institute of Genetics of Japan Cat#1010Ab-1 Anti-b-tubulin DSHB Cat# E7; RRID: AB_528499 Anti-H3K9me3 Invitrogen Cat# 720093; RRID: AB_2532803 Anti-H3K4me3 Epicypher Cat# 13-0041 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Licor Cat# 926-68071 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Licor Cat# 926-32210 Chemicals, peptides, and recombinant proteins DNase I NEB Cat# M0303S Protoscript II Reverse Transcriptase NEB Cat# M0368 5X Protoscript II Buffer NEB Cat# M0368 0.1M DTT NEB Cat# M0368 10mM dNTP mix NEB Cat# N0447 RNase Inhibitor, Murine NEB Cat# M0314 Random Primer Mix NEB Cat# S1330 LUNA Universal qPCR Master Mix NEB Cat# M3003 10X CST Lysis Buffer Cell Signaling Technologies Cat# 9803 Dynabeads M-280 Streptavidin Magnetic Beads Invitrogen Cat# 11205D Streptavidin Magnetic Beads NEB Cat# S1420 Salmon Sperm DNA Sigma-Aldrich Cat# D7656 FuGENE HD Promega Cat# E2311 5X Passive Lysis Buffer Promega Cat# E1941 10% mini-PROTEAN TGX Gel BioRad Cat# 4561034 DSP Sigma-Aldrich Cat# D3669 Proteinase K NEB Cat# T2001-1 p-formaldehyde Electron Microscopy Sciences Cat# 15710 BSA (Fraction V) Fisher Cat# BP1600 Mnase NEB Cat# M0247 Dynabeads Protein A Magnetic Beads Invitrogen Cat# 10002D (Continued on next page) 16 Cell Reports --, 115354, --, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rnase A NEB Cat# T3018 KMEDPTINDTYVQEFD-Cys Pacific Immunology Custom peptide sequence Glycine Fisher Cat# BP381 Critical commercial assays and kits Monarch Total RNA Miniprep Kit NEB Cat# T2010 Pierce Silver Stain for Mass Spectrometry Kit Thermo Scientific Cat# 24600 Amaxa SF Cell Line 4D-Nucleofector X Kit L Lonza Cat# V4XC-2024 Nano-Glo Dual-Luciferase Reporter Assay System Kit Promega Cat# N1610 NEBNext Small RNA Library Prep Kit NEB Cat# E7560 Zymo-Seq RiboFree Total RNA Library Kit Zymo Cat# R3003 Agilent DNA 1000 Kit Agilent Cat# 5067-1504 Agilent High Sensitivity DNA Kit Agilent Cat# 5067-4626 Trans-Blot Turbo RTA Mini Transfer Kit BioRad Cat# 1704272 Trans-Blot Turbo RTA Midi Transfer Kit BioRad Cat# 1704273 CUTANA ChIC/CUT&Run Kit Epicypher Cat# 14-1048 CUT&Run Library Prep Kit Version 1.1 Epicypher Cat# 14-1001 Monarch DNA/PCR Cleanup Kit NEB Cat# T1130 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645 SulfoLink Immobilization Kit for Peptides Thermo Scientific Cat# 44995 Deposited data Traffic Jam ChIP-seq from whole organism ENCODE Project Consortium.47 GEO: GSE256732 Dmel OSS cell Traffic Jam ChIP-seq This study.
other:Article Title: Discovery of cytosine deaminases enables base-resolution methylome mapping using a single enzyme.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains dam-/dcm- Competent E. coli NEB Cat# C2925H T7 Express Competent E. coli NEB Cat# C2566H Biological samples GM12878 genomic DNA Coriell Institute NA12878 Single Donor Human Plasma Innovative Research IPLASK2E2ML Unmethylated Lambda DNA Promega D1521 FX174 Virion DNA NEB Cat# N3023S FX174 RF I DNA NEB Cat# N3021S pUC19 Vector NEB Cat# N3041S CpG methylated pUC19 DNA This paper N/A XP-12 phage DNA This paper N/A 1781 bp PCR fragment amplified with dhmCTP This paper N/A T4147 phage DNA Vilnius University Life Sciences Centre N/A T4 AGT- phage DNA Vilnius University Life Sciences Centre N/A PRSSM1.PleII plasmid DNA This paper N/A Isotope-labeled firefly luciferase (Fluc) mRNA This paper N/A Chemicals, peptides, and recombinant proteins CpG Methyltransferase (M.SssI) NEB Cat# M0226S Adenosine 5’-triphosphate (ATP), ammonium salt Cambridge Isotope Laboratories Cat# NLM-3987-CA Cytidine 5’-triphosphate, ammonium salt Cambridge Isotope Laboratories Cat# CNLM-4267-CA-20 Nuclease-free Water NEB Cat# B1500S Bis-Tris Buffer 1M, pH 6.0, Sterile bioWorld Cat# 40120735-1 Triton X-100 Sigma-Aldrich Cat# 11332481001 Thermolabile Proteinase K NEB Cat# P8111S RNase Inhibitor, Murine NEB Cat# M0314S Critical commercial assays NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat# E7645S PURExpress D (aa, tRNA) Kit E6840S NEB Cat# E6840S PURExpress In Vitro Protein Synthesis Kit NEB Cat# E6800S Monarch Plasmid Miniprep Kit NEB Cat# T1010S Monarch Genomic DNA Purification Kit NEB Cat# T3010S Monarch PCR & DNA Cleanup Kit NEB Cat# T1030S NEBNext Q5U Master Mix NEB Cat# M0597S Phusion Hot Start Flex 2X Master Mix NEB Cat# M0536S Nucleoside Digestion Mix NEB Cat# M0649S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S Monarch RNA Cleanup Kit NEB Cat# T2040S Qubit RNA broad range assay Thermo Fisher Scientific Cat# Q10211 MAX V2 Cell-Free DNA Extraction Kit BioChain Cat# K5011625MA-V2 (Continued on next page) Molecular Cell 84, 854–866.e1–e7, March 7, 2024 e1
Article Title: RNF25 confers mRNA damage tolerance by curbing activation of the integrated stress response.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine 3000 Invitrogen Cat# L3000008 P3000 reagent Invitrogen Cat# L3000008 Puromycin Gibco Cat# A1113803 HygromycinB Thermo Fisher Cat# 10687010 Q5 Master Mix New England BioLabs Cat# M0494L BP clonase Thermo Fischer Cat# 11789020 LR clonase Thermo Fischer Cat# 11791100 Doxycycline Hyclate Sigma Cat# D9891 Proteinase K Thermo Scientific Cat# EO0491 ISRIB Biozol Cat# MCE-HY-12495 A-92 (GCN2 inhibitor) MedChem Express Cat# HY-100877 Resazurin Sigma Cat# R7017 TRI reagent Sigma-Aldrich Cat# T9424 O-propargyl-puromycin Jena Bioscience Cat# NU-931-5 eFluor780 viability dye Thermo Cat# 65-0865-14 Alexa Fluor 488-Azide Jena Bioscience Cat# CLK-1275-1 Alexa Fluor 594-Azide Jena Bioscience Cat# CLK-1295-AZ-1 DAPI Fisher Scientific Cat# 10374068 4-thio-uridine Jena Bioscience Cat# N-RP-2304-250 4-thio-uridine Glentham Life Sciences Cat# GN6085 4-thio-uracil Sigma Cat# 440736 Protease and phosphatase inhibitor Cell Signaling Cat# 5872 SUPERase-In Thermo Fisher Cat# AM2696 BMH-21 Hölzel Cat# HY-12484 DRB Sigma Cat# D1916 ML-60218 Hölzel Cat# HY-12212 CCCP Sigma Cat# C2759 Halofuginone Hölzel Cat# HY-N1584 Anisomycin Sigma Cat# A9789 Cycloheximide Roth Cat# 8682 Ambion RNase I Fisher Scientific Cat# AM2295 Nuclease S7 (Micrococcal nuclease) Sigma Cat# 10107921001 EGTA Roth Cat# 3054 RNase Inhibitor, Murine NEB Cat# M0314 GlycoBlue Coprecipitant Fisher Scientific Cat# AM9515 DNase I, RNase-free Thermo Scientific Cat# EN0521 Turbo DNase Thermo Fisher Cat# AM2238 Novex Tris–borate–EDTA (TBE)-Urea Sample Buffer Invitrogen Cat# LC6876 SYBR Gold Nucleic Acid Gel Stain Thermo Scientific Cat# S11494 T4 polynucleotide kinase NEB Cat# M0201 NEBNext Ultra II Q5 Master Mix NEB Cat# M0544 Resazurin Sigma Cat# R7017 Sodium Ascorbate Sigma Cat# A7631 MTSEA biotin-XX linker Biotium Cat# BT90066 AquaLive/Dead Invitrogen Cat# L34965 ActinGreen 488 ReadyProbes Reagent Thermo Scientific Cat# R37110 Critical commercial assays CellTiter Glo Assay Kit® Promega Cat# G7570 (Continued on next page) e2 Molecular Cell 86, 1275–1292.e1–e12, April 2, 2026
Article Title: Integrative characterization of MYC RNA-binding function.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BCA Protein Assay Kit Thermo Scientific Cat# 23225 ECL Western Blotting Substrate Thermo Scientific Cat# 32106 RNA Clean & Concentrator-5 Zymo Research Cat# R1016 DNA Clean & Concentrator-5 Zymo Research Cat# D4014 RNeasy Mini Kit Qiagen Cat# 74104 MinElute Gel Extraction Kit Qiagen Cat# 28604 QIAprep Spin Miniprep Kit Qiagen Cat# 27106 QIAquick PCR Purification Kit Qiagen Cat# 28106 DNeasy Blood &Tissue Kit Qiagen Cat# 69504 Qubit 1× dsDNA HS Assay Kit Invitrogen Cat# Q33231 Qubit Protein BR Assay Kit Invitrogen Cat# A50668 ssDNA Assay Kit Invitrogen Cat# Q10212 Deposited Data eCLIP-seq, endogenous MYC This study GEO: GSE252697 FLAG-MYC eCLIP-seq, MCF-7 This study GEO: GSE200344 MYC/TBP rChIP-seq This study GEO: GSE252695 MYC/TBP rCUT&RUN This study GEO: GSE252694 FLAG-MYC eCLIP-seq, U2OS This study GEO: GSE273775 FLAG-MYC ChIP-Rx This study GEO: GSE252696 MAX ChIP-Rx This study GEO: GSE273776 RNA-seq This study GEO: GSE273777 Unprocessed raw images This study Mendeley Data: https://doi.org/10.17632/3fc4n7j3g9.1 Experimental models: cell lines NIH/3T3 ATCC Cat# CRL-1658; RRID: CVCL_0594 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 K562 ATCC Cat# CCL-243; RRID: CVCL_0004 HepG2 ATCC Cat# HB-8065; RRID: CVCL_0027 U2OS ATCC Cat# HTB-96; RRID: CVCL_0042 HCT116 ATCC Cat# CCL-247; RRID: CVCL_0291 MCF-7 ATCC Cat# HTB-22; RRID: CVCL_0031 HEK293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Oligonucleotides See Table S8 for oligonucleotides This study N/A Recombinant DNA psPAX2 Didier Trono Addgene# 12260 pCMV-VSV-G Stewart et al.54 Addgene# 8454 pLKO.1 TRC Cloning Vector Moffat et al.55 Addgene# 10878 pLKO.1 shCtrl This study N/A pLKO.1 shMYC This study N/A pLVX-IRES-hygro Clontech Cat# 632185 pLVX-CMV-Flag-IRES-hygro This study N/A pLVX-Flag-MYCWT shRNA-resistant This study N/A pLVX-Flag-MYCKRR3A shRNA-resistant This study N/A pLVX-Flag-MYC7A shRNA-resistant This study N/A pLIX_403 David Root Addgene# 41395 pLIX-Flag-MYCWT doxycycline-inducible This study N/A pLIX-Flag-MYCKRR3A doxycycline-inducible This study N/A (Continued on next page) Cell Genomics 5, 100878, July 9, 2025 e3 Article ll OPEN ACCESS
Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Staining:Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
Cell Culture:Article Title: The divergent effects of G3BP orthologs on human stress granule assembly imply a centric role for the core protein interaction network.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Goat anti-Mouse IgG H&L (IRDye 800CW) preadsorbed Abcam Cat# ab216772; RRID: AB_2857338 IRDye 800CW Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–32210; RRID: AB_621842 IRDye 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–32211; RRID: AB_621843 IRDye 680RD Goat anti-Mouse IgG LI-COR Biosciences Cat# 926–68070; RRID: AB_10956588 IRDye 680RD Goat anti-Rabbit IgG LI-COR Biosciences Cat# 926–68071; RRID: AB_10956166 Bacterial and virus strains Rosetta (DE3) Chemically Competent Cell BioMed Cat# BC204-01 DH5a Chemically Competent Cell TsingKe Cat# TSC-C14 Chemicals, peptides, and recombinant proteins bis(sulfosuccinimidyl)suberate (BS3) Thermo Fisher Cat# A39266 Bovine Serum Albumin, fraction V Genview Cat# FA016-25G L-Glutathione Sigma Aldrich Cat# G4251-50G Sodium arsenite solution Merck Cat# 1.06277.1003 Protease Inhibitor Cocktail (EDTA-Free,1003 in DMSO) MCE Cat# HY-K0010 RNase Inhibitor, Murine NEB Cat# M0314S DNase (RNase free) NEB Cat# M0303S Ribonuclease A Takara Cat# 740505 Chloramphenicol Inalco Cat# 1758-9321 Kanamycin sulfate Sangon Biotech Cat# A600286-0025 Ampicillin, sodium salt Sangon Biotech Cat# A610028-0025 IPTG JSENB Cat# JS0154 Coomassie Blue staining Thermo Fisher Cat# LC6060 Dithiothreitol (DTT) Sigma-Aldrich Cat# 43815 Ficoll400 Sigma-Aldrich Cat# F2637 PEI MAXTM - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) Polysciences Cat# 24765-100 LipofectamineTM 2000 ThermoFisher Cat# 11668019 Effectene Transfection Reagent (1 mL) Qiagen Cat# 301425 50-Cy3-Oligo d(T)20 Gene Link Cat# 26-4320-02 10% Formamide Sigma-Aldrich Cat# F9037-100ML SSC Buffer 20X Concentrate Sigma-Aldrich Cat# S6639-1L Dextran sulfate Sigma-Aldrich Cat# D8906-10G iFluor 488 succinimidyl ester ATT Bioquest Cat# 1023 Gibco DMEM, High Glucose, Pyruvate Thermo Fisher Cat# C11995500CP SF 921 Insect Cell Culture Medium Expression System Cat# 96-001-01 Gibco Opti-MEM Reduced Serum Medium Thermo Fisher Cat# 31985070 Fetal Bovine Serum, Premium, Heat-Inactivated ExCellBio Cat# FSP500 Penicillin-Streptomycin MACKLIN Cat# Q6532 Imidazole Sigma-Aldrich Cat# I2399-100G GFP-Trap Magnetic Agarose Chromotek Cat# gtma-20 TRIzolTM Thermo Fisher Cat# 15596018 Polybrene Solarbio Cat# H8761 Polyadenylic acid Sigma-Aldrich Cat# 10108626001 Peptone Gibco Cat# 211677 Agar Sigma Cat# V900500 (Continued on next page) Cell Reports 43, 114617, August 27, 2024 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chlesterol DING GUO Cat# DH061 Dipotassium hydrogen phosphate GUO YAO Cat# 20032118 Potassium dihydrogen phosphate GUO YAO Cat# 10017618 Magnesium sulfate GUO YAO Cat# 10013018 Calcium chloride GUO YAO Cat# 20011160 Critical commercial assays HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) Vazyme Cat# R312 Phanta Max Super-Fidelity DNA Polymerase Vazyme Cat# P505 PrimeSTAR Max DNA Polymerase Takara Cat# R045A ClonExpress II One Step Cloning Kit Vazyme Cat# C112 FastPure Gel DNA Extraction Mini Kit Vazyme Cat# DC301 EndoFree Mini Plasmid Kit II TIANGEN Cat# 4992422 High Affinity Ni-Charged Resin FF Genscript Cat# L00666 Glutathione Resin Genscript Cat# L00206 ProLong Gold Antifade reagent with DAPI Invitrogen Cat# P36931 Experimental models: Cell lines Human: U2OS WT Cell Bank, Chinese Academy of Sciences.
|
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 